Copy Link
Add to Bookmark
Report
dictyNews Volume 24 Number 14
Dicty News
Electronic Edition
Volume 24, number 14
June 3, 2005
Please submit abstracts of your papers as soon as they have been
accepted for publication by sending them to dicty@northwestern.edu
or by using the form at
http://dictybase.org/db/cgi-bin/dictyBase/abstract_submit.
Back issues of Dicty-News, the Dicty Reference database and other
useful information is available at dictyBase - http://dictybase.org.
=============
Abstracts
=============
Transcriptional switch of the dia1 and impA promoter during the
growth/differentiation transition
Shigenori Hirose, Taira Mayanagi, Catherine Pears, Aiko Amagai,
William F. Loomis, and Yasuo Maeda
Eukaryotic Cell, in press
When growth stops due to the depletion of nutrients, Dictyostelium cells
rapidly turn off vegetative genes and start to express developmental genes.
One of the early developmental genes, dia1, is adjacent to a vegetative gene,
impA, on chromosome 4. An intergenic region of 654 bp separates the coding
regions of these divergently transcribed genes. Constructs carrying the
intergenic region express a reporter gene (GFP) that replaced impA in growing
cells and a reporter gene that replaced dia1 (DsRed) during development.
Deletion of a 112 bp region proximal to the transcriptional start site of
impA resulted in complete lack of expression of both reporter genes during
growth or development. At the other end of the intergenic region there are
two copies of a motif that is also found in the carA regulatory region.
Removing one copy of this repeat reduced impA expression 2-fold. Removing
the second copy had no further consequences. Removing the central portion of
the intergenic region resulted in high levels of expression of dia1 in
growing cells indicating that this region contains a sequence involved in
repression during the vegetative stage. Gel-shift experiments showed that
a nuclear protein present in growing cells recognizes the sequence
GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost
within the first 4 hours of development. Different nuclear proteins were
found to recognize the repeated sequence proximal to dia1. One of these
became prevalent after 4 hours of development. Together these regulatory
components at least partially account for this aspect of the growth to
differentiation transition.
Submitted by: William F. Loomis [wloomis@ucsd.edu]
-----------------------------------------------------------------------------
DNG1, a Dictyostelium homologue of tumor suppressor ING1 regulates
differentiation of Dictyostelium cells.
Taira Mayanagi, Aiko Amagai and Yasuo Maeda
Department of Developmental Biology and Neurosciences, Graduate School of
Life Sciences, Tohoku University, Aoba, Sendai 980-8578, Japan
Cell Mol Life Sci., in press
dng1 is a Dictyostelium homologue of the mammalian tumor suppressor ING gene.
DNG1 protein localizes in the nucleus, and has a highly conserved PHD finger
domain found in chromatin remodeling proteins. Both dng1 disruption and
overexpression impaired cell proliferation. In dng1-null cells, the
progression of differentiation was delayed in a cell-density dependent
manner, and many tiny aggregates were formed. Exogenously applied cAMP pulses
reversed the inhibitory effect caused by dng1 disruption on the aggregation
during early development, but formation of tiny aggregates was not restored.
dng1-overexpressing cells acquired the ability to chemotaxis to cAMP earlier
and exhibited enhanced differentiation. These phenotypes were found to be
coupled with altered expressions of early genes such as cAMP receptor 1 (car1)
and contact site A (csA). Furthermore, disordered histone modifications were
demonstrated in dng1-null cells. These results suggest a regulatory role of
dng1 in the transition of cells from growth to differentiation.
Submitted by: Taira Mayanagi [taira@nbiochem.med.osaka-u.ac.jp]
-----------------------------------------------------------------------------
A collection of amino acid replacement matrices derived from clusters of
orthologs
Rolf Olsen and William F. Loomis
Division of Biology. UCSD
J. Molecular Evolution, in press
Sequence divergence among orthologous proteins was characterized with 34
amino acid replacement matrices, sequence context analysis and a
phylogenetic tree. The model was trained on very large datasets of aligned
protein sequences drawn from 15 organisms including protists, plants,
Dictyostelium, fungi and animals. Comparative tests with models currently
used in phylogeny, i.e. with JTT+G± F and WAG+G± F, made on a test dataset
of 380 multiple alignments containing protein sequences from all 5 of the
major taxonomic groups mentioned, indicate our model should be preferred
over the JTT+G± F and WAG+G± F models on datasets similar to the test
dataset. The strong performance of our model of orthologous protein
sequence divergence can be attributed to its ability to better approximate
amino acid equilibrium frequencies to compositions found in alignment columns.
Submitted by: William F. Loomis [wloomis@ucsd.edu]
-----------------------------------------------------------------------------
Structural requirements of Dictyostelium differentiation-inducing factors for
their stalk-cell-inducing activity in Dictyostelium cells and
anti-proliferative activity in K562 human leukemic cells
Naomi Gokan, Haruhisa Kikuchi, Koji Nakamura, Yoshiteru Oshima, Kohei Hosaka,
and Yuzuru Kubohara*
*Gunma University IMCR, Japan.
Biochem. Pharmacol., in press
The differentiation-inducing factor-1 (DIF-1) is a lipophilic signal
molecule (chlorinated alkylphenone) that induces stalk cell differentiation
in the cellular slime mould Dictyostelium discoideum. It has also been
shown that DIF-1 and its derivative (DIF-3) suppress cell growth in
mammalian tumor cells. In the present study, in order to assess the
chemical structure-effect relationship of DIF derivatives and to develop
useful agents for the study of both Dictyostelium development and cancer
biology, we synthesized 28 analogues of DIF-1 and DIF-3 and investigated
their stalk-cell-inducing activity in Dictyostelium HM44 cells (mutant
strain) and anti-proliferative activity in human leukemia K562 cells.
HM44 cells are defective in endogenous DIF-1 production and should be
suitable for the assay for stalk-cell-inducing activity of DIF analogues.
DIF-1 and some of its derivatives at nanomolar levels were good stalk-cell
inducers in HM44 cells, whereas DIF-3 and some DIF-3 derivatives at
micromolar levels were potent anti-proliferative agents in K562 cells.
We also tried to search for antagonistic molecules against DIF-1 and DIF-3
but failed to find such molecules from the analogues used here. The present
findings would give us hints for identifying the target molecule(s) of DIFs
and also for developing novel anti-cancer drugs.
Submitted by: Yuzuru Kubohara [kubohara@showa.gunma-u.ac.jp]
==============================================================================
[End Dicty News, volume 24, number 14] 
